Site Search by Google

Human "32k" BAC Re-Array
GENSAT Collection
Filter Interpreter Application
Mapped Clones

Online Mapping Resources
Download Page
Questions and Answers

BAC Library Construction

 Cycle Sequence Reactions For Large Insert
Plasmid Templates 

The following dye-labeled terminator reaction chemistries have been designed to balance conservation of reagents with the resulting sequence product signal strength.  When coupled with BACPAC Resource template preparation, N-free read lengths of >400nts can be expected.  More emphasis can be placed on reagent conservation by further volume reduction or dilution; or on sequence product signal strength by increasing the reaction size.

Cycle Sequence Chemistry Conditions:

Chemistry3 Reaction Size4 Final Vol (ul) Primer Vol (10pmol/ul) Reaction Mix vol (ul) Template vol (ul)
ABI dRhod term 1.25x 25 1 10 14
ABI BD term 0.75x 15 1 6 8

1) Initial denaturation step: 96oC 4min.
2)                 denaturation: 96oC 10sec. 3)                        annealing:  50oC 10sec.
4)                        extension:  60oC 4min. run steps 2-4 for 100 cycles. 5)                                hold:  4-10oC.

Primers Useful For BAC and PAC Vectors:

T7.29:    5’    gccgctaatacgactcactatagggagag    29mer
T7:          5’    taatacgactcactataggg     20mer gSP6:       5’    gttttttgcgatctgccgtttc     22mer

Carlo Artieri (Simon Frasier University) notified us per email (January 6, 2005) that the standard BAC-end sequencing (BES)primer from the SP6 end (as recommended on our web site)did not work well with the pTARBAC2.1 vector (in the salmon BAC library, CHORI-214).   A new primer designed at Simon Frazier University worked flawlessly to obtain BES data for more than 4,300 BAC clones. The new primer is closer to the vector/insert junction and has the following sequence: actgtggcttgttttacaattt. (Personal Communication).

3Stock ABI Ready Reaction mixes are supplemented with 4mM MgCl2
4Refers to ABI 1x (20ul) reaction
5Annealing temp can be adjusted, based on Tm of primers used

Academic and commercial users should contact Pieter J. de Jong (, fax: (510) 450-7924).  For hybridization membranes, and individual clones, please contact BACPAC Resources (

For questions related to the site, please contact webmaster.
The use of this website is subject to the terms of use.